Current at 11/6/2011 (Online waypoint URL) You have already found this cache! Master Index    Nearest Caches Cary's Tickle Trunk by MHz (2.5/1.5) N49° 48.430  W97° 08.109 (WGS84) UTM  14U   E 634178  N 5518859 Use waypoint: GC1568N Size: Micro    Hidden on 8/17/2007 In Manitoba, Canada Difficulty:     Terrain:                     *** Cache is not at the posted coordinates!!*** This is a Cache and Cary tribute cache! If you've never met Cache and Cary, the first thing you need to know is that Cary has a tickle trunk. True, you may not always be able to see that tickle trunk but rest assured that Cary has one for he readily answers the call of anyone needing anything with "Oh! Do you need one? I've got one!" He then bounds off to retrieve said item(s) from his tickle trunk! If there is a "Tim 'The Toolman' Taylor" gene then Cary has it! He often spends lots of time in some of his favorite stores like Princess Auto and Dollarama! When he does, you never know what he will add to his tickle trunk this time! We also can't forget Cary's endless knowledge of obscure things! Here are a few of the things I've seen that tickle trunk produce: - endless supply of sparklers - *all* Hula girl accessories from the grass skirt to the flowered bra! - metal detector (Yes! He uses it for finding caches!) - portable propane powered hot water heater - Hula Hertz - ladder for that cache just out of reach - a supply of hand held, racket shaped, battery powered bug zappers - chemical handling gloves - uber police flashlight/batton - lizard pens and lizard finger puppets - all supplies for Smores including monster chocolate bars! - Slappy the Geocaching Beaver - turtle toilet seat cover - portable power pac - complete cache restoration supplies - cammo doggy outfits - dog treats galore even though Cary does not own a dog! And no one can miss the MBGA cache stickers as any cache that does not have one, Cary will stick one on it! I've never met anyone who has a greater love of gadgets and be so generous and willing to help out with anything than Cary! This cache is for you Cary! Enjoy! The posted coordinates will get you to the area but to find the cache you must solve the following: CGTCCTCGCCAATCTCGAATT CCCTTACATCAGAAGCGGAGC H=0, I=6, K=1, L=7, P=9, Q=8, R=4, S=3 Congrats to ertyu on being FTF! You can check your answers for this puzzle on Geochecker.com.

Additional Hints Hints

8/18/2007 by Kabuthunk
YES! For once the random knowledge that I once thought completely useless for any practical situation, which would never be used in the course of my life... has come to light. Thank you geocaching and shaking the dust off of that corner of my long-term memory .

Unfortunately, said knowledge has somewhat dwindled since it was in it's prime... but upon seeing the actual puzzle to this cache, I knew EXACTLY what it was referring to, and how to decode it.

The only problem however is finding a website or book that will finish connecting the dots. I may know HOW to solve it, but I need to find the specifics thereof .

This cache... I shall find in the near future. This I vow .

---------------------------------------------------

EDIT: It took me approximately half an hour of searching around online for exactly what I further needed to know... and knowing what terms to look for definitely helps the search . After poking around online, decoding the puzzle, and slapping it into my GPS... I had run out of time before previously made obligations came up. Hence... several hours later, I return home in the mood to cache. The first one in my radar? Why... it's also the closest one to my home .

One Kabuthunk and one bicycle later (not that I could imagine several Kabuthunks... my friends have told me the world isn't ready for more than one of me as is ), and I'm heading towards that cache at a moderate speed. I misjudged the location of the cache when I popped them into google maps at home though, since I thought they would be in one general area. Mental note... zoom in on the map next time . I ended up needing to go about 1.5km's further than anticipated... but that was all fine and good since I had plenty of energy to spare.

Upon arriving at the coordinates, I parked my bike and looked around. The first few places I checked turned out to be dead ends, but out of the corner of my eye I spotted something... not quite right. Investigating closer indeed confirmed that I had at last found the geocache . Cracking it open (followed by twisting it open ), I came to the conclusion that fitting a full-sized chainmail ball in the cache container might be a bit cramped... so a micromail ball got the honours.

Thanks for the awesome, AWESOME puzzle cache. I loved figuring this one out, and I'm pretty sure my brother (who coincidentally worked under Dr. McGowan at the U of M... but I don't think he's there any more) would have loved this geocache, despite not being a geocacher . I had lots of fun figuring it out, and using some of that old knowledge that has been rattling around in my brain unused for so many years .

Took: Nothing
Left: Logbook entry and micromail ball

Hints (Back)
Think genetics.